| تعداد نشریات | 32 |
| تعداد شمارهها | 856 |
| تعداد مقالات | 8,306 |
| تعداد مشاهده مقاله | 52,806,767 |
| تعداد دریافت فایل اصل مقاله | 9,238,949 |
Phylogeny of gazelles in some islands of Iran based on mtDNA sequences: Species identification and implications for conservation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Caspian Journal of Environmental Sciences | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| مقاله 3، دوره 13، شماره 1، خرداد 2015، صفحه 21-30 اصل مقاله (594.15 K) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| نوع مقاله: Research Paper | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| نویسندگان | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| M. Mirzakhah1؛ S. Naderi2؛ H.R. Rezaei1؛ D. Fadakar1؛ M. Naseri1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 1University of Gorgan | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 2University of Guilan | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| چکیده | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Different species of gazelles are among the most endangered mammals on the Asian steppes and occur in the central, southern and northwestern regions of Iran. The previous conservation efforts in this region have been incomplete due to confusion about the phylogenetic relationship among various populations. So that, different conservation programs such as ex-situ breeding and transfer of captive stocks to potential conservation units encountered the fundamental difficulties. This paper provides a phylogenetic study based on the analysis of Cytochrome b gene of mitochondrial DNA sequences in a number of individuals collected from the four wild island gazelles population (Kish, Kharg, Hormoz and Hengam) in the south of Iran which are applicable in phylogenetic studies and species identification for conservation. After comparing the obtained and retrieved sequences of Genbank in MEGA5 Software and then tracing a related phylogenetic tree, we found two different species in four islands. Therefore, from phylogenetic point of view, Kharg and Kish Islands’ populations belong to Iranian gazelle (Gazella subgutturosa) and Hengam and Hormoz Islands’ populations are Jebeer or Indian gazelle (Gazella bennettii). Thus, for these two different species, separate conservation programs should be taken to manage populations of these regions and to prevent the exchange gazelles between these Islands. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| کلیدواژهها | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gazella bennettii؛ Gazella subgutturosa؛ Islands؛ Phylogeny؛ Cytochrome b؛ mtDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| اصل مقاله | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Phylogeny of gazelles in some islands of Iran based on mtDNA sequences: Species identification and implications for conservation
M. Mirzakhah1*, S. Naderi2, H. R. Rezaei1, D. Fadakar1, M. Naseri1
1-Dept. of Environmental Sciences, University of Gorgan, Gorgan, Iran 2-Dept. of Environmental Sciences, Faculty of Natural Resources, University of Guilan, Sowmehsara, Iran
* Corresponding author’s E-mail: m.mirzakhah87@gmail.com (Received: Aug. 02.2014, Accepted: Jan. 28.2015) ABSTRACT Different species of gazelles are among the most endangered mammals on the Asian steppes and occur in the central, southern and northwestern regions of Iran. The previous conservation efforts in this region have been incomplete due to confusion about the phylogenetic relationship among various populations. So that, different conservation programs such as ex-situ breeding and transfer of captive stocks to potential conservation units encountered the fundamental difficulties. This paper provides a phylogenetic study based on the analysis of Cytochrome b gene of mitochondrial DNA sequences in a number of individuals collected from the four wild island gazelles population (Kish, Kharg, Hormoz and Hengam) in the south of Iran which are applicable in phylogenetic studies and species identification for conservation. After comparing the obtained and retrieved sequences of Genbank in MEGA5 Software and then tracing a related phylogenetic tree, we found two different species in four islands. Therefore, from phylogenetic point of view, Kharg and Kish Islands’ populations belong to Iranian gazelle (Gazella subgutturosa) and Hengam and Hormoz Islands’ populations are Jebeer or Indian gazelle (Gazella bennettii). Thus, for these two different species, separate conservation programs should be taken to manage populations of these regions and to prevent the exchange gazelles between these Islands.
Keywords: Gazella bennettii, Gazella subgutturosa, Islands, Phylogeny, Cytochrome b, mtDNA
INTRODUCTION
It is expected that half of the earth’s plant and animal species will become extinct in less than a century. This sharp decline of biodiversity has been termed as extinction spasm and it is largely caused by human activities (Proenca & Pereira, 2013). Different species of gazelles are among the most endangered mammals on the Asian steppes (Wacher et al., 2010). These species are distributed more in the central and southern regions of Iran. All gazelle species populations have declined because of poaching, habitat degradation, and alternation of natural habitats to agricultural land, construction, mining, and military activities (Hemami & Groves, 2001). Also, gazelles are amongst the most taxonomically complex mammal groups (Groves, 1967, 1996, 1997; Vassart et al., 1994, 1995; Lorenzen et al., 2008). Taxonomic status of most gazelle species, particularly under the species level is not clearly understood (Wronski et al., 2010). Thus, different scientific and management programs such as ex-situ and captive breeding which were used to restock their populations have not been so prosperous. Conservation efforts for gazelles in the world include the prevention of hunting and establishment of protected areas (Lerp et al., 2011). Furthermore, most natural habitats of species have not been degraded through over-exploitation, so reintroduction efforts remain a feasible option if poaching is prevented (Hemami & Groves, 2001; Lerp et al., 2011). Some previous conservation efforts for these species have been incomplete due to confusion about the phylogenetic relationships among various populations. For example, in Moghan plains in Northwestern Iran and in Ghazvin plains in the central part of the country, the attempts to reintroduce gazelles were not successful (Zachos et al., 2010). Clarifying taxonomic relationships is essential for conservation of biodiversity, conservation genetics, and determining populations or individuals for future reintroductions (Wronski et al., 2010). Describing the genetic variation found in organisms is one of the most important objectives of conservation geneticists. Genetic variation is fundamental to retaining the biodiversity found in species, populations and ecosystems. It is defined by allelic diversity and by the percent of heterozygosity found in a population (Conway, 2001). A population with high genetic diversity may be more capable in dealing with changes in its surroundings such as outbreak of a new disease. Also, endangered organisms with small populations (especially in closed Islands without any relationship with other populations) may experience a reduction in the level of genetic variation in their populations (Conway, 2001; Aeini et al., 2007). Descriptions of morphometric characters such as pelage coloration, skull and other skeletal morphometrics are commonly used as a basis for classification (Groves, 1969; Rebholz & Harley, 1999). However, these methods lead to the different classification schemes in gazelles. The genetic researchers have the potential to assess the taxonomic and phylogenetic status of species which have been difficult to classify (Furley et al., 1988; Rebholz & Harley, 1999). As there is much misunderstanding and misinformation in the literature about several species of gazelles living in Iran, and considerable fresh gathered information over the past few years, it is appropriate to review their status and distribution, and to provide some genetic data. The lack of detailed information about phylogenetic relationships among gazelles as a very diverse group of mammals made conservation efforts complicated. This is especially because, no thorough phylogenetic or phylogeographic analysis focusing on island gazelles have been conducted. Kharg Island (also called Khark), is administered by the adjacent coastal Bushehr Province. The existence of gazelles is biologically important characteristics of this Island. Kharg and Kharku were designated as protected areas in 1960 with a total area of 2438 ha. This reserve was upgraded to wildlife refuge in the early 1970s, but Kharg was separated a few years later leaving only Kharku protected in the Kharku wildlife refuge (312 ha). The area of Kharg Island is 2100 ha (Behrouzi Rad, 2013). During the Iran-Iraq War (1985), 30 gazelles from Kharg Island were transferred to Kish Island in an attempt to preserve them. This was done in cooperation with the Iranian Department of Environment that now can be seen in the southern and eastern parts of this island. Based on the last census, their number has grown to over 600 gazelles (Iranian Department of Environment, 2013, unpublished data). Hormoz and Hengam Islands are located in the Persian Gulf in south of Iran. However, no genetic or ecological studies have been conducted on gazelles of these Islands, but based on some morphological characters and according to the Iranian Department of Environment these gazelles are Jebeer. In the present study, the taxonomic status of gazelles in four southern islands of Iran, namely Kish, Kharg, Hengam and Hormoz were investigated by analyzing 410 base pairs (bp) of cytochrome b gene (Cyt-b) of mitochondrial DNA (mtDNA). The sequences derived from collected samples from the wild in the present study as well as eight sequences of different Gazella species retrieved from GenBank were used to estimate the phylogenetic relationships. The obtained results can help to fill a remarkable gap in scientific knowledge about the gazelles in Iran and it is expected to provide a reliable insight for better management of this species.
MATERIALS AND METHODS Sample collection and DNA extraction Samples were collected from free-living populations of gazelles in Kharg, Kish, Hormoz and Hengam Islands in the Persian Gulf, south of Iran. Fresh feces were collected in the field (Table 1). By this non-invasive sampling method, capturing the animals was avoided and thus the risk of injures and disturbing these endangered animals were reduced.
Table 1.The characteristics of collected samples in the four islands.
For each individual, one sample was collected and preserved by using ethanol 96% and then transferred to the laboratory. DNAs were extracted using the AccuPrep® Stool DNA Extraction Kit following the manufacturer’s instructions.
Complementary data retrieved from GenBank The data set was completed with the Cyt-b sequences present in GenBank for the genus Gazella. After discarding the partial sequences with a high number of unknown bases and also sequences that have been shown to be chimeric, what remained are: G. subgutturosa, G. bennettii, G. gazella, G. cuvieri, G. leptoceros, G. spekei, G. erlageri and G. dorcas (Table 2). Also, one sequence of Procapra gutturosa was retrieved as outgroup.
Polymerase chain reaction (PCR), amplification, sequencing and alignments After DNA extraction, a 410 base pairs fragment of the mitochondrial cytochrome b (cyt-b) gene was amplified using the polymerase chain reaction technique, then they were sequenced in two directions. The primers used for PCR and sequencing (Rebholz & Harley, 1999) were: cyt-b: L14724, 5’_TGATATGAAAAACCATCGTTG_3’; H15149, 5’_CCTCAGAAAGATATTTGTCCTC_3’. The PCR reactions were performed in a volume of 25 µl, containing 2 µl of DNA (50 ng), 1 µM of each primer, 1 ´ PCR buffer, 200 mM of each dNTP, 1.5 mM MgCl2, and 1 unit of AmpliTaq Gold polymerase (Applied Biosystems). PCR was performed for these primers according to the protocol shown in Table 3. Then, sequencing was conducted using the BigDye Terminator Kit® (Applied Biosystems, Foster City, CA, USA) and the sequences were run on a capillary ABI 3730 DNA Analyzer sequencer® (Applied Biosystems, Foster City, CA, USA). The chromatograms were edited for correction with Seqscape v2.7 software (Applied Biosystems) and then the sequences were aligned with the ClustalW algorithm implemented in the Mega 5 software (Tamura et al., 2011) with a final correction by eye. All sequences were submitted to NCBI Genbank and deposited under accession numbers KM387291 to KM387306, KP729618 and KP729619.
Table2. mtDNA sequences retrieved from Genbank.
Table 3. PCR Conditions using primers L14724 and H15149 (Hammond et al., 2001).
Phylogenetic analysis of mitochondrial data and other genetic analysis Phylogenetic analyses were performed on mitochondrial data using Neighbor-Joining and Maximum Likelihood methods. Based on the data from Mega 5 software, the model with the lowest value of AICc is the best. Therefore Neighbor-joining analyses and Maximum Likelihood values were calculated using the Tamura-Nei (TN93+G) model. Bootstrap analyses were performed in the neighbor-joining and Maximum Likelihood options of MEGA 5 with1000 replicates. Also, Arlequin V3.5 software (Excoffier and Lischer, 2010) was used for exact determination of haplotypes, estimation of polymorphism sites, percentage of organic bases and the other genetic analysis with 100.000 Markov chain steps and a burnin of 10.000 steps.
RESULTS AND DISCUSSION The analyses were carried out using the alignment sequences of 410 bp of the mitochondrial cytochrome b (cyt-b) gene, comprising 36 sequences of gazelles with 1 sequence of other antelopes as outgroup. The resulting phylogenetic tree from the Maximum Likelihood and Neighbor-Joining analysis in MEGA5 software is shown in Figs. 1 - 2, respectively. Both obtained trees similarly show that Kharg and Kish Islands gazelles are Gazella subgutturosa, while Hengam and Hormoz Islands gazelles are Gazella bennettii.The results of haplotype number using Arlequin V3.5 Software are shown in Table 4The molecular diversity indices and percentage of organic bases for comparison between populations are shown in Tables 5 and 6, respectively.
Fig. 1. Maximum Likelihood tree based on the analysis of 410 bp of Cyt-b sequences. The resulting phylogenetic tree shows Kharg and Kish Islands gazelles are Gazella subgutturosa and Hengam and Hormoz Islands gazelles are Gazella bennettii.
Fig. 2. Neighbor-Joining tree based on the analysis of 410 bp of Cyt-b sequences. The resulting phylogenetic tree shows that Kharg and Kish Islands gazelles are Gazella subgutturosa, while Hengam and Hormoz Islands gazelles are Gazella bennettii.
Table 4. Haplotype distribution in study areas.
Table 5. Molecular diversity indices in four populations.
Table 6. Percentage of organic bases for 410 bp of Cyt-b gene.
DISCUSSION Phylogeny of gazelles Based on the obtained ML tree (Fig. 1), the genus Gazella are well supported by two different lineages: one comprising G. dorcas plus G. gazella, G. spekie, G. erlangeri; and the other including G. bennettii, G. subgutturosa, G. leptoceros and G. cuvieri. According to Lerp et al., (2013), the genus Gazella has two major clades: (1) predominantly Asian clades (G. bennettii, G. subgutturosa, G. marica, G. leptocerus and G. cuvieri) and (2) a predominantly African clade (G. dorcas, G. saudiya, G. spekei, G. gazella and G. arabica). Based on their results the sister species pairs, a desert adapted form and a humid mountain adapted form can be inferred. Two desert species; G. dorcas in Africa and G. saudiya in Arabia have a sister group relationship with mountainous G. gazella in the Levant and G. arabica in Arabia. Also, this relationship has been observed within Africa between the desert slender-horned gazelle (G. leptoceros) and the mountainous Cuvier’s gazelle (G. cuvieri) of the Atlas Mountains. A third species pair occurs in Asia; Desert species goitered gazelle (Gazella subgutturosa) and mountainous Chinkara (Gazella bennettii) is one of these situations. In the ML tree shown above, all samples of Dorcas gazelles formed a reciprocally monophyletic clade with a sister group relationship to G. gazella, G. spekie and G. erlangeri. In the second lineage, G. cuvieri and G. leptoceros clade formed a reciprocally monophyletic clade with a sister group relationship to G. subgutturosa and G. bennettii. Finally, G. subgutturosa is the sister taxon of G. bennettii. Therefore, our findings are congruent with the results from a recent phylogenetic investigation of Hammond et al., (2001), Wacher et al., (2010), Lerp et al., (2011), Lerp et al., (2013) and Fadakar et al., (2013). They analyzed the mitochondrial DNA Cyt-b gene and inferred Asian clade consists of G. subgutturosa and G. bennettii both forming a reciprocally monophyletic clade in our present phylogeny. Members of the African clade include G. cuvieri and G. leptocerus, together form a highly supported monophyletic. Also, within the NJ tree, two different lineages were well supported: one comprising G. dorcas and the other including G. bennettii, G. subgutturosa, G. leptoceros, G. spekei, G. erlangeri, G. gazelle and G. cuvieri. In the second lineage, all samples of G. gazella and G. erlangeri formed a reciprocally monophyletic clade with a sister group relationship to G. spekei and G. cuvieri; and G. leptoceros clade formed a reciprocally monophyletic clade with a sister group relationship to G. subgutturosa and G. bennettii. Finally, based on the ML tree, G. subgutturosa is the sister taxon of G. bennettii. As a result, ML and NJ trees are more congruent with other researchers’ results. So, Kharg and Kish Islands gazelles are Iranian gazelle (Gazella subgutturosa), while Hengam and Hormoz Islands gazelles are Jebeer or Indian gazelle (Gazella bennettii). According to the phylogenetic trees (Figs. 1 - 2), two populations from Hormoz and Hengam Islands share the same branch, while the two other populations from Kharg and Kish place in the other branch. Therefore, this region of Cyt-b gene is appropriate for the species level recognition of gazelles and it is not capable of distinguishing between populations of the same species. This finding is already confirmed by Fadakar et al., (2013) about Iranian gazelles. According to the results of haplotype diversity (Table 3), all the Hengam individuals belong to one haplotype. Also, four individuals of Kharg are one haplotype, while five individuals of Hormoz are another haplotype. Therefore, there was no nucleotide diversity within these populations. Indeed, analysis of 14 sequences yielded only three haplotypes, one for each population, exhibiting few number of haplotypes. As well, Kish Island individuals exhibit two haplotypes. It seems due to lack of relationship between different Islands’ populations, the fewest haplotype diversity and probably inbreeding is expected in these Islands. However, the sampling process is hard and a large scale study requires for more detailed knowledge about these populations. In Kish Island, we found two different haplotypes which are distinct from all other samples, but this is probably the result of two mutational steps. In another study in Zanjan Province (Aeini et al., 2007) the low level of haplotype and genetic diversity was observed in Persian gazelles of Sohrein, predicting that the population could be endangered. Also, the high similarity between Hormoz and Hengam Island populations indicates the possible gene flow in these populations in the past. They probably were transferred to these Islands from the same initial population. Also, Kish Island gazelles were derived from Kharg Island; hence, their populations are close to each other. Base composition of cytochorome-b sequences of five samples in Hengam and Hormoz Islands (A= 32.68, C= 26.34, T=27.07, G=13.90) show a little difference to that of the four Kharg Island ones (A= 31.22, C=28.05, T=26.34, G= 14.39) and also Kish Island samples (A= 31.28, C=28.05, T= 26.28, G= 14.39) (Table 6). The overall genetic distance between Kish, Hengam and Hormoz populations was around 0.98, while between Kharg, Hormoz and Hengam was 1.0, which according to Kankilic et al., (2012), is sufficient for separation of these species from each other. Hormoz and Hengam populations do not have any genetic distance to each other, as well as Kish and Kharg ones. Gazelles are as endangered species and exact genetic data is essential for different conservation programs such as ex-situ breeding and reintroduction or transfer of captive stocks to the potential conservation units. This situation is more complicated in small and isolated island populations confronted by different problems such as inbreeding depression and subsequent extinction. The present study is a preliminary pace of this kind of studies in these islands. Results of genetic analyses of these islands’ gazelles accompanied with morphological distinctiveness, suggest that it is an evolutionary significant unit. Thus, it should take separate conservation programs with more detailed data. To provide more reliable results on phylogenetic relationship among gazelles, sequencing on the complete Cyt-b gene and also other loci such as nuclear DNA with more samples is proposed. ACKNOWLEDGMENTSWe would like to thank the Iranian Department of Environment for sampling authorization especially Hormozgan and Bushehr Department of Environment. We also thank Wahid Zamani and Zohre Ghodsi for their help in DNA extraction, all of the guards of these areas for their help during the sampling. We would like to acknowledge anonymous reviewers for constructive comments on this paper. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| مراجع | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Aeini, B., Farahmand, H., Karami, M. & Hartl, G.B. (2007). Genetic study of Persian gazelle of Sohrein, Zanjan. International Journal of Environmental Research. 1 (4): 321-324.
Behrouzi-Rad, B. (2013). Status of population and roosting places of Indian House Crow (Corvus splendence) on Kharg Island in Persian Gulf. Journal of Environmental Conservation Research. 1(3): 59-66.
Conway, W. (2001). Conservation Genetics Sessions Guide. Senior Conservationist, Wildlife Conservation Society. Spring Symposium: 4-5.
Excoffier, L & Lischer, H.E.L. (2010). Arlequin Suite Ver. 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources. 10: 564-567.
Fadakar, D., Rezaei, H.R., Naseri, M., Mirzakhah, M., Naderi, S. & Zamani, W. (2013). Phylogenetic analysis of Persian gazelle Gazella subgutturosa (Artiodactyla, Bovidae) based on cytochorome b in central of Iran. Molecular Biology Research Communications. 2(4): 151-159.
Furley, C., Tichy, H. & Uerpmann, H.P. (1988). Systematics and chromosomes of the Indian gazelle (Gazella bennettii) (Sykes, 1831). Zeitschrift für Säugetierkunde. 53: 48–54.
Groves, C.P. (1967). The taxonomy of the gazelles (genus Gazella) of Arabia. Journal of Zoology, London. 152: 381–387.
Groves, C. (1969). On the smaller gazelles of the genus Gazella de Blainville, 1816. Zeitschrift. 34: 38–60.
Groves, C.P. (1996). Taxonomic diversity in Arabian gazelles: the state of the art, In: Greth, A., Magin, C. & Ancrenaz, M., Eds. Conservation of Arabian gazelle. National Commission for Wildlife Conservation and Development, Riyadh: 8–39.
Groves, C.P. (1997). Taxonomy of Arabian gazelles In: Habibi, K., Abuzinada, A.H. & Nader, I., Eds. The gazelles of Arabia. National Commission for Wildlife Conservation and Development, Riyadh: 24–51.
Hammond, R.L., Macasero, W., Flores, B., Mohammed, O.B., Wacher, T., & Bruford, M.W. (2001). Phylogenetic reanalysis of the Saudi gazelle and its implications for conservation. Conservation Biology. 15(4): 1123-1133.
Hemami, M. & Groves, C. P. (2001). Global Antelope Survey& Regional Action Plans: Iran, In: Mallon, D. P. .&Kingswood, S. C. Eds. Antelopes: Part 4. North Africa, the Middle East & Asia IUCN Gland, Switzerland & Cambridge, UK.114-118.
Lerp, H., Wronski, T., Pfenninger, M., & Plath, M. (2011). A phylogeographic framework for the conservation of Saharan and Arabian dorcas gazelles (Artiodactyla, Bovidae), Organisms Diversity & Evolution. 11: 317-329.
Lerp, H., Wronski, T., Butynski, T.M. & Pleth, M. (2013). Speciation of Arabian gazelles, In: Speciation: Natural processes, Genetic and biodiversity. P. Michalak, ed. Nova Science, Hauppauge, New York: 59-82.
Lorenzen, E.D., Arctander, P., & Siegismund, H.R. (2008). Three reciprocally monophyletic mtDNA lineages elucidate the taxonomic status of Grant`s gazelles. Conservation Genetic. 9: 593-601.
Proenca, V. & Pereira, H. M. (2013). Comparing Extinction Rates: Past, Present, and Future. Encyclopedia of Biodiversity. 2: 167-176.
Rebholz, W., & Harley, E. (1999). Phylogenetic relationships in the Bovid subfamily Antilopinae based on mitochondrial DNA sequences. Molecular Phylogenetics and Evolution. 12: 87-94.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology & Evolution. 28: 2731-2739.
Vassart, M., Granjon, L., Greth, A. & Catzeflis, F.M. (1994). Genetic relationships of some Gazella species: an allozyme survey. Zeitschrift fur Saeugetierkunde. 59: 236–245.
Vassart, M., Granjon, L. & Greth, A. (1995). Genetic study of Gazella gazella: chromosomal and allozymic data. Comptes rendus de l’Academie des Sciences, Sciences de la vie. Life sciences. 318: 27–33.
Wacher, T., Wronski, T., Hammond, R.L., Winney, B., Blacket, M.J., Hundertmark, K.J., Mohammed, O.B., Omer, S.A., Macasero, W., Lerp, H., Plath, M. and Bleidorn, Ch. (2010). Phylogenetic analysis of mitochondrial DNA sequences reveals polyphyly in the goitred gazelle (Gazella subgutturosa). Conservation Genetics. 12(3): 827- 831.
Wronski, T., Wacher, T., Hammond, R.L., Winney, B., Hundertmark, K.J., Blacket, M.J., Mohammed, O.B., Flores, B., Omer, S.A., Macasero, W., Plath, M., Tiedemann, R., & Bleidorn, C. (2010). Two reciprocally monophyletic mtDNA lineages elucidate the taxonomic status of Mountain gazelles (Gazella gazella). Systematics and Biodiversity. 8: 119-129.
Zachos, F.E., Karami, M., Ibenouazi, Z., Hartl, G.B., Eckert, I. & Kirschning, J. (2010). First genetic analysis of a free-living population of the threatened goitered gazelle (Gazella subgutturosa). Mammalian Biology. 75: 277-282.
Ziaie, H. (2008). A field guide to the mammals of Iran. Iranian Wildlife Center, Tehran, Iran. 432. [In Persian]. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
آمار تعداد مشاهده مقاله: 30,097 تعداد دریافت فایل اصل مقاله: 2,553 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||